5G-modified-5,phosphorothioate-modified oligomers

Catalog #	Pkg Size	Price(USD)	Quantity	Buy this product
R-M2-11063	100nmol	625.00	- +	+ Add to cart

Product description

5G-modified-5,phosphorothioate-modified oligomersis a highly stable long G-cluster functional oligonucleotide probe with a clear sequence and complete replacement of the entire chain phosphate skeleton with thiophosphate bonds. It is a classic skeleton modification model probe in nucleic acid drug development.

Appearance	N/A
Molecular Weight	N/A
Solubility	N/A
Molecular formula	N/A
Sequence	5GGGGGTGTAGCTCATAGCCG3phosphorothioate-modified oligomers
Storage	-20℃, protected from light and moisture
Transportation	4-25℃ temperature for up to 1-3 weeks
Stability	6 months

Document